Muhammad Aris, Identification, pathogenicity of bacteria and the use of gene 16S rRNA for ice-ice detection on seaweed aquaculture (Kappaphycus alvarezii). Supervised by SUKENDA, ENANG HARRIS, M. FATUCHRI SUKADI and MUNTI YUHANA. Ice-ice disease on seaweed aquaculture Kappaphycus alvarezii has a significant effect on decreasing production of seaweed. Decreasing rate of biomass and caragenan content have positive correlation with ice-ice infected thallus weight based on cohabitation test between healthy and infected thallus. Destruction of seaweed tissues occurred in accordance with incubation time of ice-ice disease. Several bacteria had been successfully isolated from infected seaweed thallus and identified using API 20 E and API NE 20 identification test. Isolate of Vibrio alginoliticus PNGK 1 had the higest pathogenicity compared to other species such as Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta and Plesiomonas shigelloides. V. alginoliticus was significantly display ice-ice symptoms on day 1 after challenge test with dose of 106 CFU/mL. Molecular characterization on V. alginoliticus showed that PNGK 1 isolate similar with V. alginoliticus strain CIFRI V-TSB1. DNA sequencing data of V. alginoliticus PNGK 1 was used as the base of specific primer design for rapid detection of bacteria on seaweed thallus. Results of specific primer design through Primer 3 Program for V. alginoliticus PNGK 1 were primer aSEFM-F ((5- CAGCCACACTGGAACTGAGA -3) and aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Amplication of V. alginoliticus PNGK 1 DNA resulted in one amplicon 201 bp. Development of rapid detection method on the present of pathogenic bacteria (V. alginoliticus PNGK 1) on seaweed thallus was conducted with several steps optimation test on PCR temperature resulted that at annealing 60oC the DNA of V. alginoliticus PNGK 1 could be detected. Using specifity test and sensitivity with that specific primer it was found a band of 201 bp. This detection method for pathogenic bacteria could be applied for early detectionof asymptoutic ice-ice sea weed.